IntechOpen

Home > Books > Mosquito-Borne Tropical Diseases [Working Title]

Open access peer-reviewed chapter - ONLINE FIRST

Molecular Signal of Undescribed Leishmania-Like Trypanosomatids in Culicidae and Ceratopogonidae Insects in a Lingering Atlantic Forest Park Restricted in a Southeast Brazilian Region

Written By

Felipe Trovalim Jordão, Thaís Costa dos Santos, Leticia Abrantes de Andrade, Gabriel Lopes Pereira, Juliana Sá Teles de Oliveira Molina, Luana Prado Rolim de Oliveira, Rodrigo Buzinaro Suzuki, Aline Diniz Cabral and Márcia Aparecida Sperança

Submitted: 01 December 2024 Reviewed: 05 May 2025 Published: 03 July 2025

DOI: 10.5772/intechopen.1010908

Mosquito-Borne Tropical Diseases IntechOpen
Mosquito-Borne Tropical Diseases Edited by Márcia Aparecida Sperança

From the Edited Volume

Mosquito-Borne Tropical Diseases [Working Title]

Márcia Aparecida Sperança

Chapter metrics overview

12 Chapter Downloads

View Full Metrics
Advertisement

Abstract

Leishmaniasis, caused by the genus Leishmania protozoa, is a complex anthropozoonotic disease characterized by the interaction of parasites, invertebrate vectors, and human and vertebrate hosts. Species of the Phlebotominae subfamily are the main Leishmania vector and Ceratopogonidae species are associated with the transmission of Leishmania from subgenus Mundinia. This study aimed to detect Leishmania species in hematophagous insects collected in a residual Atlantic Forest Park of Southeast Brazil, using the phylogenetically conserved GH18 chitinase encoding gene among basal groups of trypanosomatids. From a diverse group of dipterans, specimens of Ceratopogonidae and Culicidae were positive for a 953 bp GH18 chitinase encoding gene fragment with 97 to 98% similarity with Leishmania species of the subgenus Viannia and Leishmania from new world. These results were confirmed by phylogenetic reconstruction of the GH18 chitinase, indicating the circulation of Leishmania-like parasites and a putative role of Ceratopogonidae and Culicidae Families species of insects as its hosts.

Keywords

  • Leishmaniasis
  • Ceratopogonidae
  • Culicidae
  • Leishmania-like species
  • GH18 chitinase

1. Introduction

Leishmaniasis is an infectious disease caused by 20 of 53 known different species of the Leishmania genus protozoan parasites, belonging to the order Trypanosomatidae and the class kinetoplastida, with a large and molecular specific mitochondrion organized in mini and maxicircles concatenated DNA, the kinetoplast, that is characteristic of the group [1]. Parasites from the genus Leishmania can co-circulate in the same geographical areas and sometimes in the same group of animals as Trypanosoma genus parasites, also from the order Trypanosomatidae, and both groups are composed of dixenous and monoxenous protozoa, containing several species of parasites important to human and animal health [2].

Phylogenetic studies based on classical and modern approaches including species of host, morphology, life cycle, biochemical and molecular biomarkers, contributed to the most recent taxonomic classification of the Leishmania genus, which is divided into the clades Euleishmania and Paraleishmania. The Euleishmania clade includes four subgenera: Leishmania, Viannia, Sauroleishmania, and Mundini (Enrietti complex). Paraleishmania clade includes Endotrypanum and Porcisia subgenera (Figure 1) [3, 4, 5]. Of the total described species, 20 are incriminated to cause disease in humans, and most of them are zoonotic [6]. Leishmania parasites from subgenera Leishmania, Viannia and Sauroleishmania are transmitted to humans, domestic dogs, and wild animal hosts by insect sandfly vectors of the Psycodidae family, in the old world, the Phlebotomus and Lutzomyia genus in the new world, the Americas [6]. However, besides Phlebotomus species, midge species of the Ceratopogonidae insect family have been incriminated as vectors in the transmission of Leishmania species of the Subgenus Mundinia [7, 8], indicating a possible role of other dipterans in the transmission cycle of Leishmania species.

Figure 1.

Taxonomic classification of Leishmania genus modified from Klatt et al., 2019.

Leishmaniasis is caused mainly by the species of the subgenus Leishmania, Viannia and Mundinia, which are associated with the host immunity conditions, Leishmania species, geographical origin and the clinical outcome ranging from mild tegumentar ulcerations (TL) to fatal visceral infection (VL). Species of Leishmania from the Sauroleishmania subgenus are considered non-pathogenic, infect mainly reptiles and some species can sporadically infect humans [9, 10]. The World Health Organization (WHO) data rank leishmaniasis among the 10th neglected tropical diseases, with over 12 million individuals at risk of infection, being prevalent in 99 countries. The most affected countries in the old world are India, Sudan and Kenya whereas Brazil, Colombia and Peru account for the most TL and VL cases incidence in the American continent [11, 12]. In India and the Mediterranean countries, VL is caused principally by L. infantum and L. donovani [13]. In the Americas, VL is also caused by L. infantum, which was brought to the Americas by Mediterranean colonizers in infected dogs [14]. TL can be manifested differently according to the species of Leishmania, affecting several countries worldwide, mainly Afghanistan, Algeria, Colombia, Brazil, Iran, Syria, Ethiopia, Sudan, Costa Rica and Peru [15]. In South America, L. (Viannia) braziliensis, L. (Leishmania) amazonensis and L. (Leishmania) mexicana are endemic and cause LT with the occurrence of disfiguring disease. Identification of circulating Leishmania species in an endemic area is important to prevent severe disease outcomes since leishmaniasis presents a chronic infection characteristic [16, 17, 18, 19].

The most accepted theory to explain the origins of parasites from the Leishmania genus is the supercontinent hypothesis that states the origin of Leishmania on Gondwana, emerging from monoxenous parasites [20]. An important drawback in the phylogenetic reconstruction of basal trypanosomatids, including Leishmania species, corresponds to its missing diversity knowledge, giving difficulties in culture isolation and the necessity of large genetic informative sites to be set up directly on biological sources. In previous studies, our research group obtained congruent data on phylogenetic reconstruction of Leishmania genus and basal trypanosomatids using the GH18 chitinase encoding gene, compared to the SSU rRNA. The GH18 molecular target has also been used to identify Leishmania species directly from biological specimens [21, 22]. The GH18 chitinase encoding gene is highly conserved, present as a single copy in the genome of basal groups of Trypanosomatidae, including the Leishmania genus, and is absent in the Trypanosoma genus, being an excellent molecular target to identify Leishmania genus species in the field, by PCR [21, 22].

In the state of São Paulo, southeast region of Brazil, Chagas’s disease caused by T. cruzi and leishmaniasis caused by Viannia species of Leishmania are endemic and affect humans and animals, as domestic dogs [23]. The introduction of Lutzomyia longipalps following the highway construction in the eastbound direction of São Paulo state is associated with LV expansion caused by L. infantum chagasi [24], resulting in co-circulation of different species of Leishmania and T. cruzi. An example of this situation occurs in Marilia city, localized on the border of the principal highway, Marechal Rondon, of the São Paulo Brazilian state. The city of Marília is located at the beginning of two river basins with several springs of regional importance and a predominant Atlantic Forest biome, with remnants of semi-deciduous vegetation on the outskirts of the urban perimeter. The characteristics of the landscape of Marília are conducive to the occurrence of a great diversity of arthropods and animals typical of the Atlantic Forest biome, which coexist with the human population [25]. Thus, the objective of this study was to investigate the diversity of Leishmania genus parasites in the Rangel Pietraroia Municipal Forest Park, reminiscent of the Atlantic Forest biome localized in Marilia City, an endemic region of TL and VL leishmaniasis, by surveillance of hematophagous insects with the gene encoding the GH18 chitinase from Leishmania.

Advertisement

2. Methodology

2.1 Area of study

The study took place in the city of Marília, located in the Central-West region of São Paulo, in the westernmost part of the Serra de Agudos, at 490° 56′ 46′′ longitude and 230° 13′ 10′′ south latitude. It is 443 km away from the state capital by road, 529 km by rail, and 376 km in a straight line. According to data from the IBGE, the population of approximately 220,000 people is divided, with 95% residing in urban areas and 5% in rural areas, making it a medium-sized city. It has fragments of Atlantic Forest distributed in a 554-hectare Forest Garden, a 17.36-hectare Municipal Forest, an area reserved for reforestation of 2000 hectares, and an area of 7400 hectares of natural vegetation. Collection of insects was performed in the Rangel Pietraroia Municipal Forest Park, which is in an urban environment (Figure 2) and has several species of wild animals, including agouti, opossum and coati, as well as other animals kept in captivity. These characteristics are associated with the presence of a large diversity of insect vectors, including several species of hematophagous such as sandflies, Anopheles, Aedes aegypti and Aedes albopictus.

Figure 2.

Satellite image of the region of the city of Marília in the State of São Paulo acquired on Google Maps, highlighted in red on the map of the State. The Rangel Pietraróia Municipal Forest Park is highlighted in green (white arrow).

2.2 Insect collection

Diptera insects were collected in the Rangel Pietraroia Forest Park in the city of Marília, São Paulo, Brazil, using CDC light traps and a white Shannon trap. CDC traps have a round structure that covers them, protecting them from rain and other materials, and can be attached with a rope. The body of the equipment consists of a motor with a small light bulb that attracts the insects and sucks them into the collection bag. Each trap is connected to a rechargeable battery that lasts 16 hours (Figure 3). The white Shannon trap was set up inside the forest, and the insects were sucked up using human attractants (Figure 3). The CDC traps were exposed from 5:00 p.m. and removed at 8:00 a.m. the following day, remaining in place for 1 week in each location. The Shannon trap was set up every day from 8:30 a.m. to 11:30 a.m. and then from 3:00 p.m. to 6:00 p.m. The collected insects were stored in the freezer for 15 minutes. Afterward, they were transferred to 50 ml falcon tubes containing 80% alcohol for preservation and storage and identified with the trap number, location, collection date and time. The collection protocol was authorized (authorization number 64603-1) by the Biodiversity Authorization and Information System (SISBIO), of the Chico Mendes Institute for Biodiversity Conservation (ICMBio), of the Brazilian Ministry of the Environment (MMA).

Figure 3.

A. CDC light trap; B. white Shannon trap.

2.3 Culicidae screening

The insects stored in 80% alcohol were transferred to the Laboratory of Pathogenic Agents at UFABC, São Bernardo do Campo campus for screening according to the identification key criteria in the book Neotropical Culicidae: Volumes I and II – John Lane, 1953; Medical Culicidology: Identification, Biology, Epidemiology – Vol. 2 – Oswaldo Paulo Forattini, 1924; Main mosquitoes of sanitary importance in Brazil – Rotraut A. G. B. Consoli and Ricardo Lourenço de Oliveira, 1994. After identifying the insects up to the highest taxonomic level, they were separated into males and females, hematophagous, and with or without the presence of blood.

2.4 Extraction of nucleic acid

Total nucleic acids were extracted from insects using a non-destructive technique [26]. Using this technique, it was possible to obtain genomic DNA and maintain the insect’s morphological structure intact for identification. The nucleic acid extraction method consists of incubating the insect in lysis solution (200 mM Tris-HCl, 250 mM NaCl, 25 mM EDTA, 0.5% SDS, 400 ug of proteinase K for 16 h at 56°C). Subsequently, the lysate was transferred to a new 1.5 mL tube, and 80% ethanol was added to the insect. The lysate obtained was used for DNA extraction using the DNeasy® Blood and Tissue DNA Extraction Kit (QIAGEN®, Valencia, CA, USA), according to the supplier’s instructions. The quantification and determination of the quality of the nucleic acids of each of the samples were obtained after electrophoresis in 1% agarose gel and stained with Safe Blue® according to the manufacturer, visualized in an ultraviolet light transilluminator and photographed.

2.5 Detection of Leishmania by PCR endpoint

Molecular identification of parasites of the genus Leishmania was performed by amplification of a 953 bp fragment corresponding to the GH18 chitinase encoding gene specific to the Leishmania genus group by endpoint PCR technique [21, 27]. To confirm the quality of the extracted DNA, all samples were subjected to PCR with oligonucleotides D7F and D7R to amplify a fragment corresponding to the gene encoding the 28S fraction of the dipteran rRNA [28]. The sequence of the oligonucleotides used and the PCR reaction conditions are described in Table 1.

Name5′-3’ SequenceConditionsAmpliconRef.
Quit224FowT58_60GTTCMACTACGAGGCCTTCTTCAA3 min 94°C/40x 94°C 30 seg; 64°C 45 seg; 72°C 30 seg/7 min 72°CNt224–1172 Chit (953 bp)[21]
Quit1182Rev_Tm55CAGATCATTATCCCAGACAAGTT
28Sdiptera D7FCTGAAGTGGAGAAGGGT3 min 94°C/40x 94°C 30 seg; 50°C 30 seg; 72°C 1 min/7 min 72°C28S rRNA (400–430 bp)[29]
28Sdiptera D7RGACTTCCCTTACCTACAT

Table 1.

Oligonucleotides and PCR conditions.

2.6 GH18 chitinase fragment cloning and sequencing

The 953 bp GH18 chitinase PCR fragment products obtained from nucleic acid extracted from hematophagous insects were ligated into the pGEM-T Easy vector purchased from Promega following the manufacturer’s protocol. The ligation products were transformed into MachT1 bacteria by the calcium chloride method, described by Inoue et al (1990) [30], and stored in liquid nitrogen. Transformed bacteria were plated on LB Agar supplemented with ampicillin at 50 μg/ml, X-gal at 20 μg/ml and IPTG at 100 μM and incubated at 37°C overnight. For each PCR fragment obtained, ten ampicillin-resistant white colonies were selected for PCR screening with flanking oligonucleotides of the vector cloning region, M13F and M13R. The clones that showed the expected size of 953 bp were submitted to EcoRI restriction analysis and sequencing. All PCR and restriction analysis products were evaluated by agarose gel electrophoresis in 0.5X TBE buffer, stained with Safe Blue ® according to the manufacturer, and photographed on an ultraviolet transilluminator. Recombinant clones were subjected to the Applied Biosystems BigDye Terminator 3.1 reaction and sequenced in the ABI Prism 310 automatic sequencer (Applied Biosystems). The sequences were analyzed using the Seqman program from the DNAstar software package [31], and the nucleotide sequences were compared with sequences deposited in GenBank using the Basic Local Alignment Search Tool (BLAST) [32].

2.7 Phylogenetic reconstruction

To perform the phylogenetic reconstruction of trypanosomatides harboring the chitinase gene used to detect Leishmania DNA, a 956 bp of the encoding gene from Leishmania species and others reference trypanosomatids were obtained from GenBank and EMBL, including the Leishmania species, L. amazonensis, L. braziliensis, L. donovani, L. infantum, L. peruviania, L. shawi, L. guyanensis, L. naiffi, L. taentolae, L. turanica, L. gerbilli, L. major, L. mexicana, L. enriettii; Endotrypanum species, Endotrypanum monterogeii e L. hertigi; Leptomonas, Leptomonas seymori, Leptomonas pyrrhocoris; Blechomonas ayalai; Strigomonas culicis; Angomonas deanei; Paratrypanosoma confusum; and from the marine free-living kinetoplastida, Bodo saltans, as an external group. All chitinase reference sequences were aligned with sequences obtained from nine different insects (Table 2) using the software MEGA4 [33]. Two phylogenetic trees were constructed based on nucleotide (841 bp) and amino acid sequences (280 residues) after in silico translation of chitinase nucleotide sequence and length adjustment. The evolutionary history was inferred by the Neighbor-Joining method [34], the branch length sum of both optimal trees was the next four, and the percentage of taxa grouping was calculated by bootstrap with 1000 replicates [35]. Evolutionary distances were calculated by Tamura-Nei [36] and Poisson corrected [37] methods to nucleotides and amino acids, respectively.

FamilyTaxonomic groupSexQuantityGH18 Chitinase
CulicidaeSubfamily CulicinaeMale71
CulicidaeSubfamily CulicinaeFemale82
CulicidaeSubfamily CulicinaeUndetermined2
CulicidaeGenus AedesMale141
CulicidaeGenus AedesFemale154
CulicidaeMansonia GenusMale8
CulicidaeAnopheline TribeMale2
PsycodidaePhlebotominaeFemale1
CeratopogonidaeCeratopogonidaeUndetermined41

Table 2.

Classification of hematophagous mosquitoes and GH18 chitinase positives.

Advertisement

3. Results and discussion

The objective of this study was to investigate the diversity of Leishmania genus species using the basal trypanosomatids conserved GH 18 chitinase encoding gene in hematophagous dipterans, collected in the Rangel Pietraroia Municipal Forest Park, a reminiscent of Atlantic Forest biome of Marilia city, located at the Brazilian state of São Paulo.

A total of approximately 200 insects were collected with CDC and Shannon traps, and after morphological classification, 61 were identified as belonging to hematophagous dipteran groups and were classified to the lowest possible taxonomic level (Table 2). The hematophagous insects identified belonged to three families of Diptera: Culicidae (56), Psycodidae (1) and Ceratopogonidae (4). Of the 56 Culicidae, 17 were from subfamily Culicinae (7 males, 8 females, and 2 undetermined); 29 insects were classified in tribe Aedinii and genus Aedes (14 males and 15 females); 8 male insects of the Mansoniini tribe and Mansonia genus; and 2 male insects of the Anophelinae tribe. None of the insects of the Aedes genus were of the aegypti or albopictus species. All groups of hematophagous dipterans found are typical of the semidecidual Atlantic forest landscape and similar taxonomic groups have been found in others reminiscent of the Atlantic forest in parks of São Paulo state [38].

Nucleic acids were obtained individually from all 56 dipterans using the method described by Santos et al. [26]. Quality of the DNA obtained was verified by amplification of a 434 bp fragment of the Diptera 28 S rRNA encoding gene (data not shown).

The gene encoding GH18 chitinase is specific to basal group trypanosomatids, including Leishmania genus, and it is absent in Trypanosoma species, being an excellent target to investigate the diversity of basal Trypanosomatidae family parasites [22]. Nucleic acids extracted from hematophagous dipterans collected in Marilia Park were submitted to PCR with oligonucleotides (Table 1) that amplify a 956 bp fragment corresponding to the chitinase encoding gene (Figure 4). All fragments with approximately 956 bp were cloned in the pGEM-T vector (Figure 5) and Sanger sequenced.

Figure 4.

Electrophoresis in 1% agarose gel stained with SafeBlue to evaluate the PCR amplification of a 956 bp fragment of the Leishmania sp. GH18 chitinase. 1-56: different species of hematophagous dipterans. M:1 Kb plus molecular mass ladder purchased from ThermoScienfic.

Figure 5.

Electrophoresis in 1% agarose gel stained with SafeBlue to evaluate the EcoRI digestion of 26 recombinant clones of the 956 bp PCR fragment of the Leishmania sp. GH18 chitinase in pGEM-T. The EcoRI pGEM-T digestion releases the cloned insert. At least two independent clones for each PCR fragment were obtained. M:1 Kb plus molecular mass ladder purchased from ThermoScienfic.

After BLAST analysis, PCR fragments from nine specimens of dipterans cloned in pGEM-T presented high similarity to Leishmania GH18 chitinase from subgenera Viannia and new world Leishmania. All nine sequences are new and were not described in the GeneBank sequence public database. From these, eight were obtained from dipterans of the Culicidae family, subfamily Culicinae. Of these, four were from the genus Aedes. One specimen of Ceratopogonidae was positive for Leishmania GH18 chitinase, which presented high similarity to the GH18 chitinase of the subgenus Viannia. To verify the phylogenetic position of the GH18 chitinase obtained sequences among the similar sequence of basal trypanosomatids and Leishmania genus, the 956 bp GH 18 chitinase nucleotide and amino acid sequences were submitted to Neighbor-Joining analysis. The results are presented in Figures 6 and 7.

Figure 6.

Phylogenetic reconstruction of the nucleotide sequence of the GH18 chitinase specific for Leishmania species. The tree obtained had the sum of the branch lengths of 4.18864032.

Figure 7.

Phylogenetic reconstruction of the amino acid sequence of the GH18 chitinase specific for Leishmania species. The tree obtained had the sum of the branch lengths of 4.90561768.

The ecoepidemiology of the species of Leishmania genus is associated with geographical regions of the world. In the old world (Europe, Asia, India and Africa), VL disease is associated with the circulation of L. infantum, L. donovani and L. aethiopica, while L. tropica and L. major are associated with TL. These species are from the subgenera Leishmania. TL in different regions of Africa is also associated with species of subgenus Mundinia [39, 40]. The subgenus Sauroleishmania is restricted to reptiles of the old world, and in some regions, there are species of this group associated with the infection of humans and mammals [9]. The American continent and Australia are included in the new world. In Australia, Leishmania parasites are from subgenus Mundinia, which infect mainly marsupials [41]. The Central and South American continents harbor endemic species associated with TL disease in humans and animals of subgenera Leishmania (L. mexicana, L. amazonensis), Viannia (L. braziliensis, L. shawi, L. naiffi and L. guyanensis) and Mundinia (L. martiniquensis) [41]. The occurrence of VL in the American continent is posterior to Mediterranean colonization and is caused by L. infantum from old world [14]. Brazil accounts for the majority of TL and VL disease cases in the American continent, and in some regions, several species from the genera Leishmania and Viannia, co-circulate, together with parasites from the Trypanosoma genus [42, 43, 44]. The phylogenetic analysis of the GH18 chitinase nucleotide and translated amino acid sequences obtained in this study showed they are related to the same encoding sequence of Leishmania species found in new world from genera Viannia and Leishmania (Figures 6 and 7).

Two specimens of the male Culicinae subfamily (one from genus Aedes) were positive for the GH18 chitinase encoding gene, which is not expected since Leishmania genus parasites are found only in hematophagous females of sandfly species. Leishmania is one genus of dixenous parasites, together with Endotrypanum and Porcisia; besides others, six monoxenous genera (Leptomonas, Crithidia, Zelonia, Lotmaria, Borovskyia and Zelonia) from Leishmania subfamily (Figure 8) [45, 46, 47]. Monoxenous parasites infect a single host, and in the case of Trypanosomatidae, they infect invertebrates and can be found in males infected insects. In this study, only the GH18 chitinase encoding gene was used to construct the phylogenetic relationship among Trypanosomatidae species from which there was available data on GH18 chitinase. New studies need to be performed with other molecular markers and/or with GH18 chitinase encoding gene from other Trypanosomatidae species to confirm the occurrence of Leishmania-like parasites circulation in Culicidae and Ceratopogonidae dipterans in residual Atlantic Forest parks localized in São Paulo, in the southeast region of Brazil.

Figure 8.

Trypanosomatidae taxonomic classification based on Espinosa et al. [45] and Kaufer et al. [46], modified from Kaufer et al. [47]. Groups underlined and in bold contain the GH18 chitinase encoding gene available in public data banks. Subfamilies marked with a square have at least one genus with GH18 chitinase.

Advertisement

4. Conclusions

In this study, a 97–98% similar highly conserved GH18 chitinase encoding gene among Leishmania and basal trypanosomatids were obtained from nine specimens of dipterans, eight Culicidae (four from genus Aedes), and one Ceratopogonidae, collected in a residual Atlantic semidecidual Forest localized in São Paulo, the southeast region of Brazil. Phylogenetic reconstruction positioned the obtained GH18 chitinase encoding sequences among Leishmania species of parasites from new world, the genera Viannia and Leishmania from the Americas. These results reveal the existence of an unexplored high diversity of Leishmania-like species and reinforce the need for more studies to investigate the Trypanosomatidae, an important protozoa group for global health and where several species are parasites from human, animals and plants and transmitted through arthropods.

Advertisement

Acknowledgments

This work was financed by Fundação de Amparo à Pesquisa do Estado de São Paulo (Grant number 2016/14514-4; fellowships to LAA, number 2018/05133-2; LPRO, number 2019/11384-0; and ADC, number 2013/26096-4), and Coordenação de Aperfeiçoamento de Pessoal de Ensino Superior (CAPES).

Advertisement

Conflict of interest

The authors declare no conflict of interest.

References

  1. 1. Castillo-Castaneda AC, Patino LH, Zuniga MF, Cantillo-Barraza O, Ayala MS, Segura M, et al. An overview of the trypanosomatid (kinetoplastida: Trypanosomatidae) parasites infecting several mammal species in Colombia. Parasites & Vectors. 2022;15(1):471. Epub 20221216. DOI: 10.1186/s13071-022-05595-y
  2. 2. Cervantes-Landin AY, Martinez I, Schabib M, Espinoza B. High molecular weight proteins of Trypanosoma cruzi reduce cross-reaction with Leishmania spp. in serological diagnosis tests. Biomed Res Int. 2014;2014:365403. Epub 20140720. DOI: 10.1155/2014/365403
  3. 3. Schonian G. Genetics and evolution of Leishmania parasites. Infection, Genetics and Evolution. 2017;50:93-94. DOI: 10.1016/j.meegid.2017.03.016
  4. 4. Kostygov AY, Yurchenko V. Revised classification of the subfamily Leishmaniinae (Trypanosomatidae). Folia Parasitol (Praha). 2017;64. Epub 20170710. DOI: 10.14411/fp.2017.020
  5. 5. Klatt S, Simpson L, Maslov DA, Konthur Z. Leishmania tarentolae: Taxonomic classification and its application as a promising biotechnological expression host. PLoS Neglected Tropical Diseases. 2019;13(7):e0007424. Epub 20190725. DOI: 10.1371/journal.pntd.0007424
  6. 6. Akhoundi M, Kuhls K, Cannet A, Votypka J, Marty P, Delaunay P, et al. A historical overview of the classification, evolution, and dispersion of Leishmania parasites and sandflies. PLoS Neglected Tropical Diseases. 2016;10(3):e0004349. Epub 20160303. DOI: 10.1371/journal.pntd.0004349
  7. 7. Songumpai N, Promrangsee C, Noopetch P, Siriyasatien P, Preativatanyou K. First evidence of co-circulation of emerging Leishmania martiniquensis, Leishmania orientalis, and Crithidia sp. in culicoides biting midges (Diptera: Ceratopogonidae), the putative vectors for autochthonous transmission in Southern Thailand. Trop Med Infect Dis. 2022;7(11). Epub 20221115. DOI: 10.3390/tropicalmed7110379
  8. 8. Dougall AM, Alexander B, Holt DC, Harris T, Sultan AH, Bates PA, et al. Evidence incriminating midges (Diptera: Ceratopogonidae) as potential vectors of Leishmania in Australia. Int J Parasitol. 2011;41(5):571-579. Epub 20110118. DOI: 10.1016/j.ijpara.2010.12.008
  9. 9. Mendoza-Roldan JA, Zatelli A, Latrofa MS, Iatta R, Bezerra-Santos MA, Annoscia G, et al. Leishmania (Sauroleishmania) tarentolae isolation and sympatric occurrence with Leishmania (Leishmania) infantum in geckoes, dogs and sand flies. PLoS Neglected Tropical Diseases. 2022;16(8):e0010650. Epub 20220809. DOI: 10.1371/journal.pntd.0010650
  10. 10. Ticha L, Kykalova B, Sadlova J, Gramiccia M, Gradoni L, Volf P. Development of various Leishmania (Sauroleishmania) tarentolae strains in three Phlebotomus species. Microorganisms. 2021;9(11):01-13. Epub 20211029. DOI: 10.3390/microorganisms9112256
  11. 11. Leishmaniasis [database on the Internet]. 2024. Available from: https://www.who.int/news-room/fact-sheets/detail/leishmaniasis#:~:text=Leishmaniasis%20is%20caused%20by%20protozoan,and%20lack%20of%20financial%20resources.
  12. 12. Leishmaniasis [database on the Internet]. 2023. Available from: https://www.paho.org/en/topics/leishmaniasis#:~:text=Cutaneous%20and%20visceral%20leishmaniasis%20are,645%20reported%20cases%20per%20year.
  13. 13. WHO. Working to Overcome the Global Impact of Neglected Tropical Diseases: First WHO Report on Neglected Tropical Diseases. Geneva, Switzerland: World Health Organization; 2010
  14. 14. Marcili A, Speranca MA, da Costa AP, Madeira Mde F, Soares HS, Sanches Cde O, et al. Phylogenetic relationships of Leishmania species based on trypanosomatid barcode (SSU rDNA) and gGAPDH genes: Taxonomic revision of Leishmania (L.) infantum chagasi in South America. Infect Genet Evol. 2014;25:44-51. Epub 20140416. DOI: 10.1016/j.meegid.2014.04.001
  15. 15. WHO. Weekly epidemiological record. World Health Organization International. 2016;91(22):11
  16. 16. Araujo AP, Arrais-Silva WW, Giorgio S. Infection by Leishmania amazonensis in mice: a potential model for chronic hypoxia. Acta Histochem. 2012;114(8):797-804. DOI: 10.1016/j.acthis.2012.01.007. Epub 20120222
  17. 17. Dos Santos AGA, da Silva MGL, Carneiro EL, de Lima LL, Fernandes A, Silveira TGV, et al. A new target organ of Leishmania (Viannia) Braziliensis chronic infection: The intestine. Front Cell Infect Microbiol. 2021;11:687499. DOI: 10.3389/fcimb.2021.687499. Epub 20210714
  18. 18. Ehrlich AK, Fernandez OL, Rodriguez-Pinto D, Castilho TM, Corral Caridad MJ, Goldsmith-Pestana K, et al. Local delivery of the toll-like receptor 9 ligand CpG downregulates host immune and inflammatory responses, ameliorating established Leishmania (Viannia) panamensis chronic infection. Infect Immun. 2017;85(3):e00981-16. DOI: 10.1128/IAI.00981-16. Epub 20170223
  19. 19. Martinez PA, Petersen CA. Chronic infection by Leishmania amazonensis mediated through MAPK ERK mechanisms. Immunologic Research. 2014;59(1-3):153-165. DOI: 10.1007/s12026-014-8535-y
  20. 20. Harkins KM, Schwartz RS, Cartwright RA, Stone AC. Phylogenomic reconstruction supports supercontinent origins for Leishmania. Infection, Genetics and Evolution. 2016;38:101-109. Epub 2015/12/29. DOI: 10.1016/j.meegid.2015.11.030
  21. 21. Jordão FT, Cabral AD, Pereira GL, Andrade LA, Santos ES, Suzuki RB, et al. Evolutive history of Leishmania genus and differential diagnosis of clinical important species based on a unique Kinetoplastida chitinase. International Journal of Medical Parasitology and Epidemiology Sciences. 2021;2(3):54-61. DOI: 10.34172/ijmpes.2021.16
  22. 22. Felipe Trovalim J, Aline Diniz C, Felipe Baena G, Edmar Silva S, Rodrigo Buzinaro S, Max Mario F, et al. Chitinase from Basal Trypanosomatids and Its Relation to Marine Environment: New Insights on Leishmania Genus Evolutionary Theories. In: Brajesh K, editor. Chitin-Chitosan - Isolation, Properties, and Applications. Rijeka: IntechOpen; 2023. p. Ch. 7. DOI: 10.5772/intechopen.111471
  23. 23. Valadas S, Gennari SM, Yai LE, Rosypal AC, Lindsay DS. Prevalence of antibodies to Trypanosoma cruzi, Leishmania infantum, Encephalitozoon cuniculi, Sarcocystis neurona, and Neospora caninum in capybara, Hydrochoerus hydrochaeris, from Sao Paulo state. Brazilian Journal of Parasitology. 2010;96(3):521-524. DOI: 10.1645/GE-2368.1
  24. 24. Cardim MFM, Guirado MM, Dibo MR, Chiaravalloti NF. Leishmaniose visceral no estado de São Paulo, Brasil: análise espacial e espaço-temporal. Revista de Saúde Pública. 2016;50(48):11. DOI: 10.1590/S1518-8787.2016050005965
  25. 25. Ribas EC, Biondi D, Lopes IJC, Reis ARN, Oliveira TGS. Analysis of the urban expansion of Marília, São Paulo: A look at the periurban riparian forest remnants. Interações. 2022;23(3):12. DOI: 10.20435/inter.v23i3.3525
  26. 26. Santos D, Ribeiro GC, Cabral AD, Speranca MA. A non-destructive enzymatic method to extract DNA from arthropod specimens: Implications for morphological and molecular studies. PLoS One. 2018;13(2):e0192200. DOI: 10.1371/journal.pone.0192200. Epub 20180201
  27. 27. Suzuki RB, Cabral AD, Tonhosolo R, Marcili A, Sanches COCC, Martins LPA, et al. A highly sensitive and specific conventional molecular diagnosis for Leishmania infantum chagasi based on a single copy gene. Journal of Molecular Biomarkers and Diagnosis. 2015;7(1):4. DOI: 10.4172/2155-9929.1000269
  28. 28. McDonagh LM, Stevens JR. The molecular systematics of blowflies and screwworm flies (Diptera: Calliphoridae) using 28S rRNA, COX1 and EF-1alpha: insights into the evolution of dipteran parasitism. Parasitology. 2011;138(13):1760-1777. Epub 20110826. DOI: 10.1017/S0031182011001089
  29. 29. Schonian G, Nasereddin A, Dinse N, Schweynoch C, Schallig HD, Presber W, et al. PCR diagnosis and characterization of Leishmania in local and imported clinical samples. Diagnostic Microbiology and Infectious Disease. 2003;47(1):349-358. DOI: 10.1016/s0732-8893(03)00093-2
  30. 30. Inoue H, Nojima H, Okayama H. High efficiency transformation of Escherichia coli with plasmids. Gene. 1990;96(1):23-28. DOI: 10.1016/0378-1119(90)90336-p
  31. 31. Burland TG. DNASTAR's Lasergene sequence analysis software. Methods in Molecular Biology. 2000;132:71-91. DOI: 10.1385/1-59259-192-2:71
  32. 32. Elizabeth Cha I, Rouchka EC. Comparison of current BLAST software on nucleotide sequences. Proceedings of the IPDPS Conference. 2005;19:8. DOI: 10.1109/IPDPS.2005.145
  33. 33. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution. 2007;24(8):1596-1599. Epub 20070507. DOI: 10.1093/molbev/msm092
  34. 34. Saitou N, Nei M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution. 1987;4(4):406-425. DOI: 10.1093/oxfordjournals.molbev.a040454
  35. 35. Felsenstein J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution. 1985;39(4):783-791. DOI: 10.1111/j.1558-5646.1985.tb00420.x
  36. 36. Tamura K, Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution. 1993;10(3):512-526. DOI: 10.1093/oxfordjournals.molbev.a040023
  37. 37. Zuckerkandl E, Pauling L. Molecules as documents of evolutionary history. Journal of Theoretical Biology. 1965;8(2):357-366. DOI: 10.1016/0022-5193(65)90083-4
  38. 38. Carvalho GCC, Ceretti-Junior W, Barrio-Nuevo KM, Wilk-da-Silva R, Christe RO, Paula MB, et al. Composition and diversity of mosquitoes (Diptera: Culicidae) in urban parks in the south region of the city of São Paulo, Brazil. Biota Neotropica. 2017;17(2):7. DOI: 10.1590/1676-0611-BN-2016-0274
  39. 39. Blaizot R, Pasquier G, Kone AK, Duvignaud A, Demar M. Cutaneous leishmaniasis in sub-Saharan Africa: A systematic review of Leishmania species, vectors and reservoirs. Parasites & Vectors. 2024;17(1):318. DOI: 10.1186/s13071-024-06381-8. Epub 20240724
  40. 40. Sunyoto T, Verdonck K, El Safi S, Potet J, Picado A, Boelaert M. Uncharted territory of the epidemiological burden of cutaneous Leishmaniasis in sub-Saharan Africa-a systematic review. PLoS Neglected Tropical Diseases. 2018;12(10):e0006914. DOI: 10.1371/journal.pntd.0006914. Epub 20181025
  41. 41. Panahi E, Stanisic DI, Skinner EB, Faddy HM, Young MK, Herrero LJ. Detection of Leishmania (Mundinia) macropodum (Kinetoplastida: Trypanosomatidae) and heterologous Leishmania species antibodies among blood donors in a region of Australia with marsupial Leishmania endemicity. International Journal of Infectious Diseases. 2023;130:42-47. DOI: 10.1016/j.ijid.2022.10.006. Epub 20221012
  42. 42. da Costa AP, Costa FB, Soares HS, Ramirez DG, Mesquita ET, Gennari SM, et al. Trypanosoma cruzi and Leishmania infantum chagasi infection in wild mammals from Maranhao state, Brazil. Vector Borne and Zoonotic Diseases. 2015;15(11):656-666. DOI: 10.1089/vbz.2015.1771. Epub 20151026
  43. 43. Fernandes AR, Pimenta CL, Vidal IF, Oliveira GC, Sartori RS, Araujo RB, et al. Risk factors associated with seropositivity for Leishmania spp. and Trypanosoma cruzi in dogs in the state of Paraiba, Brazil. Revista Brasileira de Parasitologia Veterinária. 2016;25(1):90-98. DOI: 10.1590/S1984-29612016010. Epub 20160311
  44. 44. Trueb I, Portela RD, Franke CR, Carneiro IO, Ribeiro GJ Jr, Soares RP, et al. Trypanosoma cruzi and Leishmania sp. infection in wildlife from urban rainforest fragments in Northeast Brazil. Journal of Wildlife Diseases. 2018;54(1):76-84. DOI: 10.7589/2017-01-017. Epub 20171004
  45. 45. Espada CR, Ortiz PA, Shaw JJ, Barral AMP, Costa JML, Uliana SRB, et al. Identification of Leishmania (Viannia) species and clinical isolates of Leishmania (Leishmania) amazonensis from Brazil using PCR-RFLP of the heat-shock protein 70 gene reveals some unexpected observations. Diagnostic Microbiology and Infectious Disease. 2018;91(4):312-318. DOI: 10.1016/j.diagmicrobio.2018.03.004. Epub 20180312
  46. 46. Kaufer A, Stark D, Ellis J. Evolutionary insight into the trypanosomatidae using alignment-free phylogenomics of the kinetoplast. Pathogens. 2019;8(3):01-17. DOI: 10.3390/pathogens8030157. Epub 20190918
  47. 47. Kaufer A, Stark D, Ellis J. A review of the systematics, species identification and diagnostics of the Trypanosomatidae using the maxicircle kinetoplast DNA: From past to present. International Journal for Parasitology. 2020;50(6-7):449-460. DOI: 10.1016/j.ijpara.2020.03.003. Epub 20200422

Written By

Felipe Trovalim Jordão, Thaís Costa dos Santos, Leticia Abrantes de Andrade, Gabriel Lopes Pereira, Juliana Sá Teles de Oliveira Molina, Luana Prado Rolim de Oliveira, Rodrigo Buzinaro Suzuki, Aline Diniz Cabral and Márcia Aparecida Sperança

Submitted: 01 December 2024 Reviewed: 05 May 2025 Published: 03 July 2025

© The Author(s). Licensee IntechOpen. This content is distributed under the terms of the Creative Commons Attribution 4.0 International License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Your cart

Discounts available on purchase of multiple copies. View rates

Subtotal £0.00

Local taxes (VAT) are calculated in later steps, if applicable.

Support: orders@intechopen.com